View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_18 (Length: 376)
Name: NF10174_low_18
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 22 - 362
Target Start/End: Complemental strand, 27602430 - 27602089
Alignment:
| Q |
22 |
ttacctgatatctgcaacaatacattttgtacaagcttaccatacgagctactaatcaaattttctgagcaagaagaacacacctatgtttaaatgcaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27602430 |
ttacctgatatctgcaacaatacattttgttcaagcttaccatacgagctactaatcaaattttctgagcaagaagaacacacctatgtttaaatgcaga |
27602331 |
T |
|
| Q |
122 |
attatgtttcatttttagactgccatatcaaatatggaaatatttgtgcaactgtcatctagatgttattttagggacaactatattttactgatttact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27602330 |
attatgtttcatttttagactgccatatcaaatatggaaatatttgtgcaactgtcatctagatgttattttagggacaactatattttactgatttact |
27602231 |
T |
|
| Q |
222 |
tactttggtggcctatccacatgttagtattaagtgtccatgcccgagcaactcaaatttccagtttcgttttcaatttttcttgaagtatgggggtcat |
321 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27602230 |
tactttggtggtctatccacatgttagtattaagtgtccatgcccgagcaactcaaatttccagtttcgttttcaatttttcttgaagtatgggggtcat |
27602131 |
T |
|
| Q |
322 |
ttactat-ccctggtacgattttgatacttgcaggttcatct |
362 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27602130 |
ttactatcccctggtacgattttgatacttgcaggttcatct |
27602089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University