View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_24 (Length: 351)
Name: NF10174_low_24
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 44533700 - 44533930
Alignment:
| Q |
17 |
acaaatactacaagaaaatgaaggaaagtaacaagcaaaggcgtgatgatagtaagacatgtccttattttaatgaacttgaagctatttacaaagaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533700 |
acaaatactacaagaaaatgaaggaaagtaacaagcaaaggcgtgatgatagtaagacatgtccttattttaatgaacttgaagctatttacaaagaaaa |
44533799 |
T |
 |
| Q |
117 |
gaacaaaacacagaacctttttggttctaattcgtttcatagcatgaagtcaaatgagacgatggagccattgatggtgcagccagaacaacaatggaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533800 |
gaacaaaacacagaacctttttggttctaattcgtttcatagcatgaagtcaaatgagacgatggagccattgatggtgcagccagaacaacaatggaga |
44533899 |
T |
 |
| Q |
217 |
cctccaactacatttgaagagggtgatgtgg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44533900 |
cctccaactacatttgaagagggtgatgtgg |
44533930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University