View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_30 (Length: 336)
Name: NF10174_low_30
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 5 - 312
Target Start/End: Complemental strand, 40659214 - 40658907
Alignment:
| Q |
5 |
agaggagaagcatagggcaggctcaacttgggtggtgttttattcccgcttcagatatcggccttcttacacctggctcagttcggtacctgagttaccg |
104 |
Q |
| |
|
|||| |||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40659214 |
agagaagaatcatggggcaggctcaacttgggtggtgttttattccggcttcagatatcggccttcttacacctggctcagttcggtacctgagttaccg |
40659115 |
T |
 |
| Q |
105 |
gctacgaggtaaagacggttccaggggacatgccataatcaacatctccgtcagattggagataacgacgttgatgtcatcgaacatggacacatgtcac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40659114 |
gctacgaggtaaagacggttccaggggacatgccataatcaacatctccgtcagattggagataacgacattgatgtcatcgaacatggacacatgtcac |
40659015 |
T |
 |
| Q |
205 |
actgtcattgggatacctgtgacaacctttcgaggaacttaattaccatggttgaaagtggtttagcaggggtcagtgtcatcccgaattggatttcctg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40659014 |
actgtcattgggatacctgtgacaacctttcgaggaacttaattaccatggttgaaagtggtttagcaggggtcagtgtcatcccgaattggatttcctg |
40658915 |
T |
 |
| Q |
305 |
atgttaca |
312 |
Q |
| |
|
|||||||| |
|
|
| T |
40658914 |
atgttaca |
40658907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University