View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_36 (Length: 303)
Name: NF10174_low_36
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 14782395 - 14782110
Alignment:
| Q |
1 |
gtgaggaggtttttgacaagggaagtagggtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782395 |
gtgaggaggtttttgacaagggaagtagggtttattgggtgacggttatggctaatgtcgtgacgtggcagttttgttttatggggactgctgggatggt |
14782296 |
T |
|
| Q |
101 |
gtttttgacatcttcattaactggtgggatttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782295 |
gtttttgacatcttcattaactggtgggatttgcatgacagctttgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggt |
14782196 |
T |
|
| Q |
201 |
ttgaaagctgtttcaactgttatgtgtatgtggggattttgttcttatgtttatggtatgtatgttaagatgttggaagagaaagg |
286 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782195 |
ttgaaagctgtttcaactgttttgtgtatgtggggattttgttcttatgtttatggtatgtatgttaagatgttggaagagaaagg |
14782110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 287
Target Start/End: Complemental strand, 14774509 - 14774232
Alignment:
| Q |
10 |
tttttgacaagggaagtagggtttattgggtgacggttatggcgaatgtcgtgacgtggcagttttgttttatggggactgctgggatggtgtttttgac |
109 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14774509 |
tttttgataagggaagtttggtttattgggtgacagttatggctaatgtggtgacgtggcagttttgttttatgggaactgctggaatggtgtttttgac |
14774410 |
T |
|
| Q |
110 |
atcttcattaactggtgggatttgcatgacagcattgttgtctatgaatgtgttgggtggtgttatagtttatagagatgcatttggtggtttgaaagct |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||| | || | ||||||||||||||||||| | || ||| |
|
|
| T |
14774409 |
atcttcattaactggtgggatttgtatgacagctttgttgtctatgaatgtgttgggaggtgttttggtgtttagagatgcatttggtggtgttaaggct |
14774310 |
T |
|
| Q |
210 |
gtttcaactgttatgtgtatgtggggattttgttcttatgtttatggtatgtatgttaagatgttggaagagaaaggt |
287 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14774309 |
gtttcaactgttttgtgcatgtggggattctgttcttatgtttatggtatgtatgttaagatgttggaagagaaaggt |
14774232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University