View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_39 (Length: 296)
Name: NF10174_low_39
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 10 - 281
Target Start/End: Complemental strand, 31026501 - 31026230
Alignment:
| Q |
10 |
gcataggcttgactttgaagtcctttttgggataaaatgcgacgattattttggggaactctgctaatttagccaacttaatttttgctttagctttctt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31026501 |
gcataggcttgactttgaagtcctttttgggataaaatgcgacgattattttggggaactctgctaatttaaccaacttaatttttgctttagctttctt |
31026402 |
T |
 |
| Q |
110 |
acaccagctgcagctacttacacataacagctattctccttattttacatattcttagtttgtttaatcatagatttcttatattgacatattatgaaga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31026401 |
acaccagctgcagctacttacacataacagctattctccttattttacatattcttagtttgtttaatcatagatttcttatattgacatattatgaaga |
31026302 |
T |
 |
| Q |
210 |
atgcaatttctgatattggtcaaaagatctaccttcgcttacacaaaaattgaaaatgaagatagaactatg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31026301 |
atgcaatttctgatattggtcaaaagatctaccttcgcttacacaaaaattgaaaatgaagatagaactatg |
31026230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University