View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_52 (Length: 254)
Name: NF10174_low_52
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 35029734 - 35029504
Alignment:
| Q |
19 |
acagttgcatcaagaggcaaattgtgaaaacaagtggattggatttgttggaaaatggagtgaggagggtaagatcattcttatacttgttatgttgctt |
118 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35029734 |
acagttgcatcgagaggcaaattgtgaaaacaagtggattggatttgttggaaaatggagtgatgagggtaagatcattcttatacttgttatgttgctt |
35029635 |
T |
|
| Q |
119 |
ggaagactcaagagattcaacacggatgcaggtaatccatggaaacttctctgattcttgaatatcaattctacccaacatcagctccgatttcacacaa |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
35029634 |
ggaagactcaagaaattcaacacggatgcgggtaatccatggaaacttctctgattcttgaatatcaattctacccaacatcaactctgatttcacacaa |
35029535 |
T |
|
| Q |
219 |
atgtgtgatctatgatcgatttcatctcact |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
35029534 |
atgtgtgatctatgatcgatttcatatcact |
35029504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 37 - 175
Target Start/End: Complemental strand, 34970419 - 34970281
Alignment:
| Q |
37 |
aaattgtgaaaacaagtggattggatttgttggaaaatggagtgaggagggtaagatcattcttatacttgttatgttgcttggaagactcaagagattc |
136 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| |||||| |||||||| ||||||| || || | |||| |
|
|
| T |
34970419 |
aaattgtgaaaacaaatggattggatttgttgggaaatggagtgatgagggtaagatcattctcatacttattatgttgtttggaaggcttaaaaaattc |
34970320 |
T |
|
| Q |
137 |
aacacggatgcaggtaatccatggaaacttctctgattc |
175 |
Q |
| |
|
|||| ||||| ||| || ||||||||||||||||||||| |
|
|
| T |
34970319 |
aacatggatggaggcaagccatggaaacttctctgattc |
34970281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 34952582 - 34952406
Alignment:
| Q |
19 |
acagttgcatcaagaggcaaattgtgaaaacaagtggattggatttgttggaaaatggagtgaggagggtaagatcattcttatacttgttatgttgctt |
118 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||| || |
|
|
| T |
34952582 |
acagttgcatccagagacaaattgtgaaaacaaatggattggatttgttggaaaatggagtgatgagggtaagatcattctcatatttgttatgttgttt |
34952483 |
T |
|
| Q |
119 |
ggaagactcaagagattcaacacggatgcaggtaatccatggaaacttctctgattcttg---aatatcaattctac |
192 |
Q |
| |
|
||||| || || | |||||| | ||||| ||| || ||||||| |||| |||||| || |||||||||||||| |
|
|
| T |
34952482 |
ggaaggcttaaaaaattcaatatggatggaggcaaagcatggaagcttcattgattcatgatcaatatcaattctac |
34952406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University