View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_53 (Length: 252)
Name: NF10174_low_53
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 40208003 - 40207784
Alignment:
| Q |
1 |
ttgttcaaagttccatttcttc---ttgaatttatcgtcctattgtcagttatttgattgcttgttactctatatgatctatgatatgtcaatattgtat |
97 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208003 |
ttgttcaaagttccatttctgcagcttgaatttatcgtcctattgtcagttatttgattgcttgttactctatatgatctatgatatgtcaatattgtat |
40207904 |
T |
 |
| Q |
98 |
acaaggggtgaacataatgctgattcatcagtagatcttgttggatttctagccaaatactctcaatggcctgtagtaacattgggtcctaattggtgca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40207903 |
acaaggggtgaacataatgctgattcatcagtagatgttgttggatttctagccaaatactctcaatggcctgcagtaacattgggtcctaattggtgct |
40207804 |
T |
 |
| Q |
198 |
tgattaaacatagaatcgag |
217 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
40207803 |
aggttaaacatagaatcgag |
40207784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University