View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_62 (Length: 249)
Name: NF10174_low_62
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 26486050 - 26486242
Alignment:
| Q |
18 |
gtttgccattgtcaccaacctggtcgacgtgttgttctttctgatcgttgtaaacttgctagcgacgtcttgacttggtcaagccatacgagatgggtca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26486050 |
gtttgccattgtcaccaacctggtcgacgtgttgttctttctaatcgttgtaaacttgctagcgacgtcttgacttggtcaagccatacgagatgggtca |
26486149 |
T |
 |
| Q |
118 |
tctatttgatgcattattggaaatctacgtgtggatgattggtcattaatattggaaaaacctactacaattttcttactaatctactataga |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
26486150 |
tctatttgatgcattattggaattctacgtgtggatgattggtcattaatattggaataacctactacgattttcttactaatctactataga |
26486242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University