View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10174_low_66 (Length: 246)

Name: NF10174_low_66
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10174_low_66
NF10174_low_66
[»] chr7 (3 HSPs)
chr7 (1-217)||(7309764-7309973)
chr7 (89-203)||(7330063-7330181)
chr7 (17-61)||(7330012-7330056)


Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 7309973 - 7309764
Alignment:
Q  1 tctttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagcgacaagcatgaatgatggaac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||    
T  7309973 tctttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagc-------atgaatgatggaac 7309881  T
Q  101 atggcggcagaatgttatgaagaaaaatattgcagcttattggaacttgtttgtttattgtactaattttacagagcctattttcacccgagctaaaact 200  Q
    |||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  7309880 atggcggcagaatgctatgaagcaaaatattgcagctttttggaacttgtttgtttattgtactaattttatagagcctattttcacccgagctaaaact 7309781  T
Q  201 ccattgctatttatgag 217  Q
    |||||||||||||||||    
T  7309780 ccattgctatttatgag 7309764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 89 - 203
Target Start/End: Original strand, 7330063 - 7330181
Alignment:
Q  89 gaatgatggaacatggcggcagaatgttatgaagaaaaatattgcagcttattgg------aacttgtttgtttattgtactaattttacagagcctatt 182  Q
    |||||||||| |||||| || ||||| ||||||||||||||||| ||||||||||      |||||||||| |||||||||| |||||  | || |||||    
T  7330063 gaatgatggagcatggctgcggaatgctatgaagaaaaatattggagcttattggaactacaacttgtttggttattgtactcatttt--atagtctatt 7330160  T
Q  183 ttcacccgagctaaaactcca 203  Q
    |||||||||||||||||||||    
T  7330161 ttcacccgagctaaaactcca 7330181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 7330012 - 7330056
Alignment:
Q  17 tattgttgaaattggttcattttgaattgtagatctacaacctga 61  Q
    ||||||| |||| ||||||||||||||||||||||||||||||||    
T  7330012 tattgtttaaatgggttcattttgaattgtagatctacaacctga 7330056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University