View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_69 (Length: 243)
Name: NF10174_low_69
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 43814349 - 43814227
Alignment:
| Q |
1 |
ttaatttaattaagcacattaagctaaagttcaagtaatttttatatgcaggtctccccgcagctctacggggacaaccgccctagaatttttatttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43814349 |
ttaatttaattaagcacattaagctaaagttcaagtaatttttatatgcaggtctccccgcagctctacggggacaaccgccctagaatttttatttatt |
43814250 |
T |
|
| Q |
101 |
ggacggtaagtaaattgatcgaa |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43814249 |
ggacggtaagtaaattgatcgaa |
43814227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 139 - 226
Target Start/End: Complemental strand, 43814172 - 43814085
Alignment:
| Q |
139 |
ctttatgaattagtaaaagaaaaaatgacaagagtaataatacttgcattgcaggctgatgcgtacaaacacgggtgctacaacttaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43814172 |
ctttatgaattagtaaaagaaaaaatgacaagagtaataatacttgcattgcaggctgatgcgtacaaacacgggtgctacaacttaa |
43814085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 38 - 119
Target Start/End: Original strand, 29235087 - 29235168
Alignment:
| Q |
38 |
atttttatatgcaggtctccccgcagctctacggggacaaccgccctagaatttttatttattggacggtaagtaaattgat |
119 |
Q |
| |
|
|||| ||||||||||||| ||| || ||||| || ||||||||||||||| | |||||||| |||||||||||||||||||| |
|
|
| T |
29235087 |
atttatatatgcaggtcttcccacaactctatggagacaaccgccctagattgtttatttactggacggtaagtaaattgat |
29235168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 45 - 108
Target Start/End: Original strand, 29366493 - 29366556
Alignment:
| Q |
45 |
tatgcaggtctccccgcagctctacggggacaaccgccctagaatttttatttattggacggta |
108 |
Q |
| |
|
||||||| ||| |||| || ||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
29366493 |
tatgcagatctacccgaaggtctacggggacaaccgcactagattttttatttattggacggta |
29366556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 124
Target Start/End: Complemental strand, 29213202 - 29213107
Alignment:
| Q |
27 |
aagttcaagtaatttttatatgcaggtctccccgcagctctacggggacaaccgccctagaatttttatttattggacggtaagtaaattgatcgaag |
124 |
Q |
| |
|
||||| ||||||||||||| ||||||| ||| ||||||| ||||| | | ||||||| | |||| |||||||||||||||||||||||| |||| |
|
|
| T |
29213202 |
aagtttaagtaatttttat--gcaggtcagcccagagctctatggggatagctaccctagattctttacttattggacggtaagtaaattgattgaag |
29213107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 110
Target Start/End: Original strand, 29384858 - 29384923
Alignment:
| Q |
45 |
tatgcaggtctccccgcagctctacggggacaaccgccctagaatttttatttattggacggtaag |
110 |
Q |
| |
|
||||||| ||| |||| || |||| ||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
29384858 |
tatgcagatctacccgaaggcctactgggacaaccgcactagattttttatttattggacagtaag |
29384923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University