View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_72 (Length: 242)
Name: NF10174_low_72
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 9994185 - 9994392
Alignment:
| Q |
17 |
caaaggtttaggactaaagtaattaagaagagtttgaatcctaaatgggatgaagagtttagttttaaggtggatgatcttaaagaagagttggtagttt |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9994185 |
caaaggtttaggactaaagtgattaagaagagtttgaatcctaaatgggatgaagagtttagttttaaggtggatgatcttaaagaagagttggtagttt |
9994284 |
T |
|
| Q |
117 |
ctgttatggatgaagataagtttttgattgatgactttgttggtcaacttaaagttcctatgtcacttgtttttgatgaggagattaaatcacttggtac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9994285 |
ctgttatggatgaagataagtttttgattgatgactttgttggtcaacttaaagttcctatgtcacttgtttttgatgaggagattaaatcacttggtac |
9994384 |
T |
|
| Q |
217 |
tgcttggt |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
9994385 |
tgcttggt |
9994392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University