View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_79 (Length: 238)
Name: NF10174_low_79
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 44050123 - 44049899
Alignment:
| Q |
1 |
tgcaagtgtctaagtctgtctcatatctataatactacttcaaggtttcatgaaattcaacaatacttgaatgagatgacacgagtcttaccttccttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44050123 |
tgcaagtgtctaagtctgtctcatatctataatactacttcaaggtttcatgaaattcaacaatacttgaatgagatgacacgagtcttacctcccttct |
44050024 |
T |
|
| Q |
101 |
gatcctattatggttgatgaactaatttcctatgaaataccaacacaaacacggacattgataacaatttaagaaaataaacgtagtcaaatataactaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44050023 |
gatcctattatggttgatgaactaatttcctatgaaataccaacacaaacacggacattgataacaatttaagaaaataaacgtagtcaaatataactaa |
44049924 |
T |
|
| Q |
201 |
acgtgttaatgacgcgtcgttgttg |
225 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
44049923 |
acgtgttaatgtcgcgtcgttgttg |
44049899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University