View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_82 (Length: 234)
Name: NF10174_low_82
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_82 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 1241344 - 1241573
Alignment:
| Q |
1 |
aaggcaggaacaccttgctttgtcttgtgagagttcacttttcagctgtattgttcagcttgaagttaagaataaagggaacatgagatcattgttggtg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1241344 |
aaggtaggaacaccttgctttgtcttgtgagagttcacttttaagctgtattgttcagcttgaagttaagaataaagggaacatgagatcattgttggtg |
1241443 |
T |
 |
| Q |
101 |
atatggtatggacatataaaggttcatgttgtctatttcatttgcatgtcactattgaaatagatagtcaagatgagttat-tttttagtgaattgcact |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1241444 |
a-----tatggacatataaaggttcatgttgtctatttcatttgcatgtcactattgaaatagatagtcaagatgagttatatttttagtgaattgcact |
1241538 |
T |
 |
| Q |
200 |
ttgctgctttaaattttctaaacaataatgttatg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1241539 |
ttgctgctttaaattttctaaacaataatgttatg |
1241573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University