View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_83 (Length: 231)
Name: NF10174_low_83
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 35 - 213
Target Start/End: Original strand, 2907743 - 2907921
Alignment:
| Q |
35 |
ttattgatgtgtgtaagtacaaaatatccttttgataaatttaaatggattaattactatttagggttatacttaaaacttaaaagaaaaggaggtcaag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2907743 |
ttattgatgtgtgtaagtacaaaatatccttttgataaatttaaatggattaattactatttaggggtatacttaaaacttaaaagaaaaggaggtcaag |
2907842 |
T |
 |
| Q |
135 |
atgttcatctcattcccctctctcctgggaatgagattgagatgtaaactctttttggtggaatctagcagtattatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2907843 |
atgttcatctcattcccctctctcctgggaatgagattgagatgtaaactctttttggtggaatctagcagtgttatat |
2907921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University