View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_88 (Length: 227)
Name: NF10174_low_88
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_88 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 44050332 - 44050107
Alignment:
| Q |
1 |
tttggtggagaaaatgggagttgtaactcttggtgaattgaagcctagtgtttcaggaagaaggacttttcgtccaagttcaagcataagacatgccact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44050332 |
tttggtggagaaaatgggagttgtaactcttggtgaattgaagcctagtgtttcaggaagaaggacttttcgtccaagttcaagcataagacatgccact |
44050233 |
T |
 |
| Q |
101 |
gaatggtattataattttcttactannnnnnnnnnnnnnnnngaaggattcttactacttctagatgtttttatttatttacacatattcctagaagtta |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44050232 |
gaatggtattataattttcttacta-ttttttttctttttttgaaggattcttactacttctagatgtttttatttatttacacatattcctagaagtta |
44050134 |
T |
 |
| Q |
201 |
ttcagaaacatgcaagtgtctaagtct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44050133 |
ttcagaaacatgcaagtgtctaagtct |
44050107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 108
Target Start/End: Original strand, 39821186 - 39821282
Alignment:
| Q |
12 |
aaatgggagttgtaactcttggtgaattgaagcctagtgtttcaggaagaaggacttttcgtccaagttcaagcataagacatgccactgaatggta |
108 |
Q |
| |
|
||||||||||||| ||| | |||||||| ||||||||||||||||| | |||| ||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
39821186 |
aaatgggagttgtcactgtaggtgaatttaagcctagtgtttcagggaagaggagctttcgtccaagctcaagcataaggcatgctactgaatggta |
39821282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University