View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10174_low_92 (Length: 211)
Name: NF10174_low_92
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10174_low_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 193
Target Start/End: Complemental strand, 23047606 - 23047433
Alignment:
| Q |
20 |
tgcatcaccacgtccatagtatcctttcatcaccaaaattgaatccgaattcaacaacgacgacttcggatcatgtccttccatcctctccactcaacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23047606 |
tgcatcaccacgtccatagtatcctttcatcaccaaaattgaatccgagttcaacaacgacgacttcggatcatgtccttccatcctctccactcaacaa |
23047507 |
T |
 |
| Q |
120 |
caatggcttcgacttcagcttccgattcggcgtcaacatgttttcggtgtttccaggtcgcatacgtctgttct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23047506 |
caatggcttcgacttcagcttccgattcggcgtcaacatgttttcggtgtttccaggtcgcatacgtctgttct |
23047433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 20 - 196
Target Start/End: Original strand, 44098093 - 44098272
Alignment:
| Q |
20 |
tgcatcaccacgtccatagtatcctttcat---caccaaaattgaatccgaattcaacaacgacgacttcggatcatgtccttccatcctctccactcaa |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
44098093 |
tgcatcaccacgtccataatatcctttcatcatcaccaaaattgaatccgagttcaacaacgacgacttcgggtcctgtccttccatcctctccactcaa |
44098192 |
T |
 |
| Q |
117 |
caacaatggcttcgacttcagcttccgattcggcgtcaacatgttttcggtgtttccaggtcgcatacgtctgttctctg |
196 |
Q |
| |
|
||||||||||||| ||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44098193 |
caacaatggcttcagcttcaacttccgattcagcgtcaacatgtttccggtgtttccaggtcgcatacgtctgttctctg |
44098272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University