View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10175_low_11 (Length: 232)
Name: NF10175_low_11
Description: NF10175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10175_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 6917047 - 6916847
Alignment:
| Q |
17 |
gaatttggaacattgtggaattttgaggggtcataaattggcggttttgtgtttggcggcggctggaagtttggtgtttagtggttctgctgacatggca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917047 |
gaatttggaacattgtggaattttgaggggtcataaattggcggttttgtgtttggtggcggctggaagtttggtgtttagtggttctgctgacatggca |
6916948 |
T |
|
| Q |
117 |
atttgtgtgtggaaacgatcgattactaatgaacatgtttgtatgtcagtgttgagtggacatactggaccggtgaagtgtctcgctgctgagaaggatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916947 |
atttgtgtgtggaaacgatcgattactaatgaacatgtttgtatgtcagtgttgagtggacatactggaccggtgaagtgtctcgctgctgagaaggatc |
6916848 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
6916847 |
t |
6916847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University