View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10175_low_9 (Length: 241)
Name: NF10175_low_9
Description: NF10175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10175_low_9 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 3765 - 3976
Alignment:
| Q |
11 |
agagagaagaaggttttacacaggtgacatatacccagatgcatattttatttggtgcgttttgaagttatctttcattattttcacagccgaatctttt |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3765 |
agagaaaagaaggttttacacaggtgacaaatacccagatgcatattttatttggtgcgttttgaagttatctttcattattttcacagctgaatctttt |
3864 |
T |
|
| Q |
111 |
atttcgtgtcattgtttcacttattttggtggctaggagatgaaggttttacacagttgacattatatatcgttgaaagtttttatcatacacactcttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3865 |
atttcgtgtcattgtttcacttattttggtggctaggagatgaaggttttacacagttgacattatatatcgttgaaagtttttatcatacacactcttc |
3964 |
T |
|
| Q |
211 |
aaacttcaacat |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3965 |
aaacttcaacat |
3976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University