View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10176_high_33 (Length: 221)
Name: NF10176_high_33
Description: NF10176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10176_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 35689442 - 35689240
Alignment:
| Q |
1 |
caaactctataaaatttccgaatccaactcctgaaccaccctgttaagttcaatgttttgaaacttcatgtcacaaacacataaaaacatggattgttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
35689442 |
caaactctataaaatttccgaatccaactcctgaaccaccctgttaagttcaatgttttgaaacttcattttacaaacacataaaaacatggattgttct |
35689343 |
T |
 |
| Q |
101 |
tgttcaaaattcaaatcatgccctaattcaaataatacttacaggtcctccctgcaaccagagaatgattggccatggtttggagggattctccactttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35689342 |
tgttcaaaattcaaatcatgccctaattcaaataatacttacaggtcctccctgcaaccagagaatgattggccatggtttggagggattctccactttg |
35689243 |
T |
 |
| Q |
201 |
tag |
203 |
Q |
| |
|
||| |
|
|
| T |
35689242 |
tag |
35689240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University