View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| ||||||||||||||||
Alignment Overview
Query: NF10176_low_23 (Length: 316)
Name: NF10176_low_23
Description: NF10176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| |||||
| ||||||
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 9439718 - 9439510
Alignment:
| Q | 18 | atatcttattttttggagacatgattaggttgactaactgcatttgtgaatcataggagtgagaaagtatttggatagtaagaaaaaggtagaagaaaac | 117 | Q |
| ||||||||||| ||||||||||||||| ||| | ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| | ||||
| T | 9439718 | atatcttatttgttggagacatgattatgttcgcaaactgcatttgtgaatcataggagtgacaaagtatttggatagtaagcaaaaggtagaagaaaac | 9439619 | T |
 | ||||
| Q | 118 | cagaggttactctgcagagtcagatacaacattttctatccttaaatccattaggatagatcctcttccactctcccactttcttcttataatttttgcg | 217 | Q |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| | ||||
| T | 9439618 | cagaggttactctgcagagtcagatacaacattttctatccttaaatccattaggatagatcctcttccactctcccactttcttcatataattcttgcg | 9439519 | T |
| ||||
| Q | 218 | aattccctc | 226 | Q |
| ||||||||| | ||||
| T | 9439518 | aattccctc | 9439510 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 9439512 - 9439483
Alignment:
| Q | 265 | ctccgagggaatatctggtctaaaattctt | 294 | Q |
| |||||||||||||||||||||||||||||| | ||||
| T | 9439512 | ctccgagggaatatctggtctaaaattctt | 9439483 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University