View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10176_low_27 (Length: 292)
Name: NF10176_low_27
Description: NF10176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10176_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 33926193 - 33925918
Alignment:
| Q |
1 |
ctacatcagaagaagtgaaacgcatgatggaagaactcgatcaaaacggcgacggtttcattgatctgaaagaattcgctgattttcactgtactgaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33926193 |
ctacatcagaagaagtgaaacgcatgatggaagaactcgatcaaaacggcgacggtttcattgatctgaaagaattcgctgattttcactgcactgaacc |
33926094 |
T |
|
| Q |
101 |
tggaaaagatgaatctagcgagcttcgtgatgcttttgatctttacgatcttgataagaatggtttgatttctgctaatgaattgcacgctgttttgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33926093 |
tggaaaagatgaatctagcgagcttcgtgatgcttttgatctttacgatcttgataagaatggtttgatttctgctaatgaattgcacgctgttttgatg |
33925994 |
T |
|
| Q |
201 |
aaactcggtgagaaatgctcgttgaatgattgtaagaagatgattagtaatgttgatgttgacggtgatggaaatg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33925993 |
aaactcggtgagaaatgctcgttgaatgattgtaagaagatgattagtaatgttgatgttgacggtgatggaaatg |
33925918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 90
Target Start/End: Original strand, 1893072 - 1893150
Alignment:
| Q |
12 |
gaagtgaaacgcatgatggaagaactcgatcaaaacggcgacggtttcattgatctgaaagaattcgctgattttcact |
90 |
Q |
| |
|
||||| ||||||||||||||| || | ||||| ||||||||||||| ||||||||| ||||||||| | ||||| |||| |
|
|
| T |
1893072 |
gaagtaaaacgcatgatggaacaaattgatcagaacggcgacggttacattgatctcaaagaattcaccgatttccact |
1893150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 12 - 88
Target Start/End: Complemental strand, 1892758 - 1892682
Alignment:
| Q |
12 |
gaagtgaaacgcatgatggaagaactcgatcaaaacggcgacggtttcattgatctgaaagaattcgctgattttca |
88 |
Q |
| |
|
||||| ||||||||||||||| || | ||||| ||||||||| ||| ||||||||| ||||||||| |||| ||||| |
|
|
| T |
1892758 |
gaagtaaaacgcatgatggaacaaattgatcagaacggcgacagttacattgatctcaaagaattcactgaatttca |
1892682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 91
Target Start/End: Original strand, 17711343 - 17711389
Alignment:
| Q |
45 |
aacggcgacggtttcattgatctgaaagaattcgctgattttcactg |
91 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
17711343 |
aacggcgacggttacatagatctcaaagaattcgctgatttccactg |
17711389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University