View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10176_low_28 (Length: 287)
Name: NF10176_low_28
Description: NF10176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10176_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 12829361 - 12829099
Alignment:
| Q |
17 |
tcacgaaacacgtcgacgttgatttcaacgaatttcagctttttctctttgaagaattttctcactgcggtacaatctctacaacttgacctcgagaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12829361 |
tcacgaaacacgtcgacgttgatttcaacgaatttcagctttttctctttgaagaattttctcactgcggtacaatctctacaacttgacctcgagaaga |
12829262 |
T |
|
| Q |
117 |
acgtgattctacctttcatcttatcatcttcttcttctccaggtttcgttttcaccacgactctgagtccagaaagattgaactctgtcacgttctcctc |
216 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12829261 |
acgtgattctccctttcatcttttcatcttcttcttctccaggtttcgttttcaccacgactctgagtcctgaaagattgaactctgtcacgttctcctc |
12829162 |
T |
|
| Q |
217 |
ttcaaccgattgtcgaaaggaagaaactcgtttcgcaatcgctgctgataaatcattgctcct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12829161 |
ttcaaccgattgtcgaaaggaagaaactcgtttcgcaatcgctgctgataaatcattgctcct |
12829099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University