View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10176_low_32 (Length: 272)
Name: NF10176_low_32
Description: NF10176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10176_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 24291300 - 24291063
Alignment:
| Q |
19 |
attggatcttcaagtataaggtattttaaggtatctaggttcgttattgttaattgtggttttgttagaagctatacttcgactaccaaacttgcagata |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24291300 |
attggatcttcaagtatcaggtattttaaggtatctaggttccttattgttaattgtggctttattagcagctatacttcgactaccaaacttgcagata |
24291201 |
T |
|
| Q |
119 |
gttgcagaaaaatgttgcttatgtgactgattgctattgcagttgcagaggcatttaaaaatataatttttgtgattaacaaatgttgtgaattgaattt |
218 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
24291200 |
gttgcagtgaaatgttgcttatgtgactgactgccattgcagttgcagaggcatttaaaaatataatttttgtgat-------cgttgtgaattgaactt |
24291108 |
T |
|
| Q |
219 |
aatatcatatcatatttctcctatcaatggagaaagaagagttgtcaaaa |
268 |
Q |
| |
|
| | |||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
24291107 |
a-----aaatcataattctcctatcaatagagaaagaagaattgtcaaaa |
24291063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University