View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10176_low_32 (Length: 272)

Name: NF10176_low_32
Description: NF10176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10176_low_32
NF10176_low_32
[»] chr8 (1 HSPs)
chr8 (19-268)||(24291063-24291300)


Alignment Details
Target: chr8 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 24291300 - 24291063
Alignment:
19 attggatcttcaagtataaggtattttaaggtatctaggttcgttattgttaattgtggttttgttagaagctatacttcgactaccaaacttgcagata 118  Q
    ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||    
24291300 attggatcttcaagtatcaggtattttaaggtatctaggttccttattgttaattgtggctttattagcagctatacttcgactaccaaacttgcagata 24291201  T
119 gttgcagaaaaatgttgcttatgtgactgattgctattgcagttgcagaggcatttaaaaatataatttttgtgattaacaaatgttgtgaattgaattt 218  Q
    |||||||  ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||        ||||||||||||| ||    
24291200 gttgcagtgaaatgttgcttatgtgactgactgccattgcagttgcagaggcatttaaaaatataatttttgtgat-------cgttgtgaattgaactt 24291108  T
219 aatatcatatcatatttctcctatcaatggagaaagaagagttgtcaaaa 268  Q
    |     | |||||| ||||||||||||| ||||||||||| |||||||||    
24291107 a-----aaatcataattctcctatcaatagagaaagaagaattgtcaaaa 24291063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University