View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_high_13 (Length: 255)
Name: NF10177_high_13
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_high_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 49 - 255
Target Start/End: Original strand, 33612636 - 33612842
Alignment:
| Q |
49 |
aggcagacttaggtgttttaaagcctagctctggatgacctattcccacccctaattgcaatgcagcataagttttatagaaatctattagatgggattt |
148 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||| ||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
33612636 |
aggcagacttaggtgtttcaaagcctagctctggatgacctattctcatccctaattgcattgcagcacaagttttatataaatctattagatgggattt |
33612735 |
T |
 |
| Q |
149 |
gtattctactatttttcttgccgttgtaattttgcgttttgtggtaatgcagtagttaattttgtctatcggatgcatccactagcattatatttttgta |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612736 |
gtattctactatttttcttgccgttgtaattttgcgttttgtggtaatgcaggagttaattttgtctatcggatgcatccactagcattatatttttgta |
33612835 |
T |
 |
| Q |
249 |
attggtc |
255 |
Q |
| |
|
||||||| |
|
|
| T |
33612836 |
attggtc |
33612842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University