View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_high_17 (Length: 237)
Name: NF10177_high_17
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 46442339 - 46442558
Alignment:
| Q |
1 |
tgtcatcaaaattgattaatgtttgtatgttgttggatttcaataattattgttagtttgttacctttannnnnnngattattggtgatcttttactact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46442339 |
tgtcatcaaaattgattaatgtttgtatgttgatggatttcaataattattgttagtttgttacctttatttttttgattattggtgatcttttactact |
46442438 |
T |
|
| Q |
101 |
tatttattatactcttgattagcatacatattcaaagttcactttgagaatataggtgtaagattttggattcaatgacatctaggtggagattttggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46442439 |
tatttattatactcttgattagcatatatattcaaagttcactttgagaatataggtgtaagattttggattcaatgacatctaggtggagattttggat |
46442538 |
T |
|
| Q |
201 |
catttatgtttacacctttt |
220 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
46442539 |
catttatgtttacgcctttt |
46442558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University