View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_high_20 (Length: 214)
Name: NF10177_high_20
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 23522376 - 23522560
Alignment:
| Q |
12 |
gagatgaaggagtggggccaaaaggttgggtacgtgagagatattgatggcatcgtgatcagaatgggaaatcatgtaaagcctgcaaaattagattagt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522376 |
gagatgaaggagtggggccaaaaggttgggtacgtgagagatattgatggcatcgtgatcagaatgggaaatcatgtaaagcctgcaaaattagattagt |
23522475 |
T |
 |
| Q |
112 |
tatgtgcagttggacatagaagcagttggtaaaatacaatattatgttgatgtttatgtattctctgtataggttgaataagaaaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23522476 |
tatgtgcagttggacatagaagcagttggtaaaatacaatattacgttgatgtttatgtat--tctgtataggttgaataagaaaaa |
23522560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University