View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_12 (Length: 270)
Name: NF10177_low_12
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 29 - 253
Target Start/End: Complemental strand, 23784492 - 23784268
Alignment:
| Q |
29 |
attgaattaattgttctttttcaaagatggacactatcaatcgtgccaaagggtcgttacatgtgataactatatggtctagatcttgatcagatcaatg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23784492 |
attgaattaattgttctttttcaaagatggacactatcaatcgtgccaaagggtcgttacatgtgataactatatggtctagatcttgatcagatcaatg |
23784393 |
T |
 |
| Q |
129 |
gattagttgaaatttgtgatctcaccttattttactaattcaaccaaacctaaatccaattttctaatcttctttctctctcnnnnnnnctatcttgagg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23784392 |
gattagttgaaatttgtgatctcaccttattttactaattcaaccaaacctaaatccaattttctaatcttctttctctctctttttttctatcttgagg |
23784293 |
T |
 |
| Q |
229 |
aaggaaataaacatacactgttact |
253 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
23784292 |
aaggaaataaacatacactgttact |
23784268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University