View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_14 (Length: 261)
Name: NF10177_low_14
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 27068221 - 27068464
Alignment:
| Q |
1 |
tttgtttcctaatgttttcatattggggtttcaccatttctaatcaatttcaaatgtcaccactggttttgatttgcatattgtaagttgtgacaattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||| |
|
|
| T |
27068221 |
tttgtttcctaatgttttcatattggg-tttcaccatttctaatcaatttcaaatgtcaccactgattttgatttgcatattgtaagctgtaacaattcg |
27068319 |
T |
 |
| Q |
101 |
tttttgtagttttcttattcccccaaaaatttggtttatgatttccccaaaattttgtattggggtttcacgaattcagctttgtagttttctgcatgtt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27068320 |
tttttgtagttttcttattcccc-aaaaatttggtttatgatttccccaaaattttgtattggggtttcacgaattcagctttgtagttttctgcatgtt |
27068418 |
T |
 |
| Q |
201 |
ggttcactttattatttcttaaacccatcagtgtatgagtggtaac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27068419 |
ggttcactttattatttcttaaacccatcggtgtatgagtggtaac |
27068464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 96 - 137
Target Start/End: Original strand, 8633418 - 8633459
Alignment:
| Q |
96 |
attcttttttgtagttttcttattcccccaaaaatttggttt |
137 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
8633418 |
attctgttttgtagttttctgattcccccaaaaattcggttt |
8633459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University