View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_17 (Length: 252)
Name: NF10177_low_17
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 83 - 235
Target Start/End: Original strand, 52259266 - 52259418
Alignment:
| Q |
83 |
tttcattcttctgttgcagttgaattatgtcatcttttctcccaaattcaaccatgttagtgtaagaaatgagagatggaatgctcccagcatcacggta |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52259266 |
tttccttcttctgttgcagttgaattatgtcagcttttctcccaaattcaaccatgttagtgtaagaaatgagagatggaatgctcccagcatcacggta |
52259365 |
T |
 |
| Q |
183 |
aaagctcagacagctgttgaaggtgatgtaattaacaatgaatcactctcttc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52259366 |
aaagctcagacagctgttgaaggtgatgtaattaacaatgaatcactctcttc |
52259418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University