View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_20 (Length: 239)
Name: NF10177_low_20
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 33613209 - 33612993
Alignment:
| Q |
17 |
attatttaaatttatacagctaaattttcaacgattacggtgaaatcatttacttttattcatagttttaaaatgtcgcattaattaatattaaacc-gt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33613209 |
attatttaaatttatacagctaaattttcaacaattacggtgaaatcatttacttttattcatagttttaaaatgtcgcattaattaatattaaaccggt |
33613110 |
T |
|
| Q |
116 |
ttgactctaaagaccagctaagtcgccggttttaaccggtttatagcgagtcttacggtttgtaccagtttatttacataatcgattcaatatatgaatt |
215 |
Q |
| |
|
||||||||||| ||| || ||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||| | ||||||||||||||| |
|
|
| T |
33613109 |
ttgactctaaaaaccggccgagtcgtcggttttaaccggtttatagcgagtcttacggtttgtatcggtttatttacataaccaattcaatatatgaat- |
33613011 |
T |
|
| Q |
216 |
gaaccggcaaagccaccggtt |
236 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
33613010 |
---ccggcaaagccactggtt |
33612993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 42216624 - 42216552
Alignment:
| Q |
140 |
gccggttttaaccggtttatagcgagtcttac-ggtttgtaccagtttatttacataatcgattcaatatatg |
211 |
Q |
| |
|
|||||||| | ||||||| ||||||||||||| ||||| |||| |||||||||||||| |||| |||| |||| |
|
|
| T |
42216624 |
gccggtttaatccggtttttagcgagtcttaccggtttctaccggtttatttacataaccgatccaatgtatg |
42216552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 211
Target Start/End: Original strand, 6818002 - 6818072
Alignment:
| Q |
142 |
cggttttaaccggtttatagcgagtctta-cggtttgtaccagtttatttacataatcgattcaatatatg |
211 |
Q |
| |
|
|||||| | ||||||| |||||||||||| |||||| |||| |||||||||||||| |||| |||| |||| |
|
|
| T |
6818002 |
cggtttaatccggtttttagcgagtcttatcggtttctaccggtttatttacataaccgatccaatgtatg |
6818072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University