View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_21 (Length: 237)
Name: NF10177_low_21
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 5334734 - 5334951
Alignment:
| Q |
13 |
gcacagagcaagcgcgaactcactcctgaattagtcaagaatgcattctatggtccagccgcatctatgattcctgctcctcagatcaatttcgctgcca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334734 |
gcacagagcaagcgcgaactcactcctgaattagtcaagaatgcattctatggtccagccgcatctatgattcctgctcctcagatcaatttcgctgcca |
5334833 |
T |
|
| Q |
113 |
ctgttaca--cccccgccattcgc---------accacttccaaatcaaaactactttcctgctgttgctggacctcaccctgcaacttcctctgccttc |
201 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334834 |
ctgttacacccccccgccattcgcaccctttggaccacttccaaatcaaaactactttcctgctgttgctggacctcaccctgcaacttcctctgccttc |
5334933 |
T |
|
| Q |
202 |
cctgcttatggcaacatg |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5334934 |
cctgcttatggcaacatg |
5334951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 13 - 125
Target Start/End: Original strand, 43470609 - 43470721
Alignment:
| Q |
13 |
gcacagagcaagcgcgaactcactcctgaattagtcaagaatgcattctatggtccagccgcatctatgattcctgctcctcagatcaatttcgctgcca |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | || || |||||| ||||||||||| ||||| | ||||||||| |||||||||||||| ||||||| |
|
|
| T |
43470609 |
gcacagagcaagcgtgaactcactcctgaaatggttaaagctgcattgtatggtccagctgcatccaagattcctgcccctcagatcaattttgctgcca |
43470708 |
T |
|
| Q |
113 |
ctgttacaccccc |
125 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
43470709 |
ctgtcacaccccc |
43470721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 158 - 219
Target Start/End: Original strand, 43470838 - 43470899
Alignment:
| Q |
158 |
ttcctgctgttgctggacctcaccctgcaacttcctctgccttccctgcttatggcaacatg |
219 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
43470838 |
ttcctgctgtttctggacctcgccctgcaacttcctccgccttccctgggtatggcaacatg |
43470899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University