View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_6 (Length: 381)
Name: NF10177_low_6
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 1 - 357
Target Start/End: Complemental strand, 3746913 - 3746557
Alignment:
| Q |
1 |
ggagctgatgggaacatgtttggttaattggtagtggaggataaaaatatgatgataggcaagcagggagttgagtgtcctaatgattgatcctgcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3746913 |
ggagctgatgggaacatgtttggttaattggttgtggaggataaaaatatgatgataggcaagcagggagttgagtgtcctaatgattgatcctgcataa |
3746814 |
T |
 |
| Q |
101 |
ttttgcagaaaattaatctttgatttagaagatgtctttagacgttgcacaaggccaatttggaaagcacataccatgttgtatgccaaaatcgataatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3746813 |
ttttgcagaaaattaatctttgatttagaagatgtctttagacgttgcacaaggccaatttggaaagcacataccttgttgtatgccaaaatcgataatc |
3746714 |
T |
 |
| Q |
201 |
agagatgctgagacatttaatcatctggatgccgcagagtcaagttaaagtaaaatggctggatgaggctacgactaataggacctagtcacagaaaagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3746713 |
agagatgctgagacatttaatcatctggatgccgcagagtcaagttaaagtaaaatggctggatgaggctacgactaataggacctagtcacagaaaagg |
3746614 |
T |
 |
| Q |
301 |
atgaatggcgagcaccaatgcacagaacgggtctaggataaggcttaggcttgcgtg |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3746613 |
atgaatggcgagcaccaatgcacagaacgggtctaggataaggcttaggcttgcgtg |
3746557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University