View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_7 (Length: 380)
Name: NF10177_low_7
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 174 - 361
Target Start/End: Complemental strand, 31536519 - 31536331
Alignment:
| Q |
174 |
tttttcctttttcataaggtccacaaaataa-taaatatgacgcagcaataaaccaaccatccaattacaccatgcagataagaagcaagatagaccact |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536519 |
tttttcctttttcataaggtccacaaaataaataaatatgacgcagcaataaaccaaccatccaattacaccatgcagataagaagcaagatagaccact |
31536420 |
T |
|
| Q |
273 |
cccttcttgatcactaaaacacatatataattcatttcccactttgtccctccgacataccttgttcctaaatccaaacaaagccagcc |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536419 |
cccttcttgatcactaaaacacatatataattcatttcccactttgtccctccgacataccttgttcctaaatccaaacaaagccagcc |
31536331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 34 - 140
Target Start/End: Complemental strand, 31536658 - 31536552
Alignment:
| Q |
34 |
atcacataagtgtgtgattcaagtaaataatattttgtttcaaagttctaaaatttgtaaaatattataagccaaacaatggttggagcttggataacaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536658 |
atcacataagtgtgtgattcaagtaaataatattttgtttcaaagttctaaaatttgtaaaatattataagccaaacaatggttggagcttggataacaa |
31536559 |
T |
|
| Q |
134 |
atataag |
140 |
Q |
| |
|
||||||| |
|
|
| T |
31536558 |
atataag |
31536552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University