View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10177_low_9 (Length: 281)
Name: NF10177_low_9
Description: NF10177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10177_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 14 - 236
Target Start/End: Original strand, 37974429 - 37974648
Alignment:
| Q |
14 |
agaccaagacaagaggttcctatacatctttatgacttcaattactgcgtgtgatccagattcactttagtactatattcatcatgttgttccaattatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37974429 |
agaccaagacaagaggttcctatacatctttatgagttcaattactgcgtgtgatccagattcactttaatactatattcatcatgttgttccaattatg |
37974528 |
T |
 |
| Q |
114 |
gtttttaaatattgattcccacttcgctcatgggtgtatgtttggattcacgttttaagaagtgtctgtttgattaagcgtctcaagttggcatatgtag |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37974529 |
gtttttaaatattgattcccactttgcttatgggtgaatgtttggattgacgtttt---aagtgtctgtttgattaagcgtcccaagttggcatatgtag |
37974625 |
T |
 |
| Q |
214 |
cttctgcctaaaggtgatttttt |
236 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
37974626 |
cttctgcctaaaggtcatttttt |
37974648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University