View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10178_high_11 (Length: 308)
Name: NF10178_high_11
Description: NF10178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10178_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 306
Target Start/End: Original strand, 23177643 - 23177933
Alignment:
| Q |
16 |
ttgatcaccccacagatacccttttgcctggaatgaacataggctacgatactgacataggacacacttggtcattgagatcatggaagagtacagacga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23177643 |
ttgatcaccccacagatacccttttgcctggaatgaacataggctacgatactgacacaggacacacttggtcattgagatcatggaagagtacagacga |
23177742 |
T |
 |
| Q |
116 |
cccctcttcaggaccatatacccttcaatatgattctcgctctgcgaatctgtctgttagtaaaggttcaaatgttttgtggattgacggtagttccaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23177743 |
cccctcttcaggaccatatacccttcaatatgattctcgctctgcgaatctgtctgttagtaaaggttcaaatgttttgtggattgacggtaattccaat |
23177842 |
T |
 |
| Q |
216 |
ttttcttttcatgatgttttgaaccgagcggagttcaaacagagctacggcttgaacaactatactactattccaattgatagcaattctc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23177843 |
ttttcttttcatgatgttttgaaccgagcggagttcaaacagagctacggcttgaacaactatactactattccaattgatagcacttctc |
23177933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 23186772 - 23186956
Alignment:
| Q |
16 |
ttgatcaccccacagatacccttttgcctggaatgaacataggctacgatactgacataggacacacttggtcattgagatcatggaagagtacagacga |
115 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||| | |||| |||||||| ||| ||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
23186772 |
ttgataaccccaccgatacccttttacctggaatgaccttaggacacgatacttacacaggacgtacttggtcattgagatcatggaagcgtacagacga |
23186871 |
T |
 |
| Q |
116 |
cccctcttcaggaccatatacccttcaatatgattctcgctctgcgaatctgtctgttagtaaaggttcaaatgttttgtggatt |
200 |
Q |
| |
|
|||||| | ||||||| ||| || | ||||||||| ||| || | |||| |||| |||||| |||||||||||| | |||||| |
|
|
| T |
23186872 |
cccctccacgggaccatttactctgcgctatgattctggctttgggtatctatctgatagtaatggttcaaatgttgtatggatt |
23186956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 21182315 - 21182232
Alignment:
| Q |
19 |
atcaccccacagatacccttttgcctggaatgaacataggctacgatactgacataggacacacttggtcattgagatcatgga |
102 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| || |||||| | ||| ||| |||||| ||| ||||||||||||| |
|
|
| T |
21182315 |
atcaccccacggatacccttttacctggaatgaacatcggacacgatattaacacagggtacactttgtctttgagatcatgga |
21182232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University