View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10178_high_16 (Length: 268)
Name: NF10178_high_16
Description: NF10178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10178_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 6e-43; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 165 - 261
Target Start/End: Complemental strand, 11555891 - 11555795
Alignment:
| Q |
165 |
caagtgactgtaaattatggtactatcataacttactaaccttttcatttcccaagcatcctttcgatatgtgatttaaatttcattgttcttctct |
261 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11555891 |
caagtgactgtaaattatagtactatcataacttactaaccttttcatttcccaagcatcctttcgatatgtgatgtaaatttcattgttcttctct |
11555795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 11530541 - 11530461
Alignment:
| Q |
1 |
ggaggagtgtattggaggaaaaaatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11530541 |
ggaggagtgtattggaggaaaaaatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
11530461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 11556038 - 11555958
Alignment:
| Q |
1 |
ggaggagtgtattggaggaaaaaatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11556038 |
ggaggagtgtattggaggaaaaaatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
11555958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 197 - 261
Target Start/End: Complemental strand, 11530213 - 11530149
Alignment:
| Q |
197 |
ttactaaccttttcatttcccaagcatcctttcgatatgtgatttaaatttcattgttcttctct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11530213 |
ttactaaccttttcatttcccaagcatcctttcgatatgtgatgtaaatttcattgttcttctct |
11530149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University