View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10178_low_18 (Length: 281)
Name: NF10178_low_18
Description: NF10178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10178_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 266
Target Start/End: Original strand, 33539113 - 33539367
Alignment:
| Q |
14 |
aggatccaggtccaagcacaaggtat--gcaccgnnnnnnngttataaatattctatttcttgactagagattgatttaggtgacaaccataaataaata |
111 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33539113 |
aggatccaggtcctagcacaaggtatatgcaccgaaaaaaagttataaatattctatttcttgactagagattgatttaggtgacaaccataaataaata |
33539212 |
T |
 |
| Q |
112 |
ttgcaaaagtattactccttccgtctttaaatataacaatctctaacaaaagtcatagagtatcaagaaaggttatgaatcctggacgtgagatctttgg |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33539213 |
ttgcaaaaatattactccttccgtctttaaatataacaatctctaacaaaagtcatagagtatcaagaaaggttatgaatcctggacgtgagatttttgg |
33539312 |
T |
 |
| Q |
212 |
tcttgaggtcatgcagacgactttggatagccggactttgcttagtaccttcttt |
266 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33539313 |
tcttgaggtcatgcagatgactttggatagccggactttggttagtaccttcttt |
33539367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University