View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10178_low_24 (Length: 250)
Name: NF10178_low_24
Description: NF10178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10178_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 55187572 - 55187324
Alignment:
| Q |
1 |
catgctgggtttctcactttcttgttatgccatttttacagagcacgccatgtttattactagaagtaaaactgtctgccaatctataagtcttacattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55187572 |
catgctgggtttctcactttcttgttatgccatttttacagagcacgccatgtttattactagaagtaaaactgtctgccaatctataagtcttacattg |
55187473 |
T |
 |
| Q |
101 |
gtctttttt-atacaaaactttgaaatggaaagctcaatcttgtttttaggtgccagtttaagggaatatacaaagattaatactgttttattacttttg |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55187472 |
gtctttttttatacaaaactttgaaatggaaagctcaatcttgtttttaggtgccagtttaagggaatatacaaagattaatattgttttattacttttg |
55187373 |
T |
 |
| Q |
200 |
taaagtttcctttatgtcccaggattgttattctgtctctgcttctcca |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
55187372 |
taaagtttcctttatttcccaggattgttattctgtttctgtttctcca |
55187324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University