View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10178_low_27 (Length: 239)
Name: NF10178_low_27
Description: NF10178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10178_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 52837691 - 52837913
Alignment:
Q |
1 |
cgccacaacaaggagaaggtttccaaatgctactataatcctctaaatcatcttcagcacggtaaaatttgtcaccttggctcaaatggtcccttaatgg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52837691 |
cgccacaacaaggagaaggtttccaaatgctactataatcctctaaatcatcttcagcacggtaaaatttgtcaccttggctcaaatggtcccttaatgg |
52837790 |
T |
 |
Q |
101 |
ccgaacaatagatactggatgctgcaccgttgatgaggatggaattaatgttaatggcatggatatcacaaccatttgtattgttgctatcatcacaatc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
52837791 |
ccgaacaatagatactggatgctgcaccgttgatgaggatggaattaatgttaatggcatggatatcacaaccattagtattgttgctatcatcacaatc |
52837890 |
T |
 |
Q |
201 |
accataatctttgaactgatttt |
223 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
52837891 |
accataatctttgaactgatttt |
52837913 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 204
Target Start/End: Complemental strand, 37444458 - 37444372
Alignment:
Q |
118 |
gatgctgcaccgttgatgaggatggaattaatgttaatggcatggatatcacaaccatttgtattgttgctatcatcacaatcacca |
204 |
Q |
|
|
|||| |||||| |||||||||||||||| ||||||||||||||||| ||| |||||||| |||||| |||||| |||||||||||| |
|
|
T |
37444458 |
gatgttgcaccattgatgaggatggaatgaatgttaatggcatggacatctcaaccattagtattgctgctatagtcacaatcacca |
37444372 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University