View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10178_low_30 (Length: 227)
Name: NF10178_low_30
Description: NF10178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10178_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 23178397 - 23178171
Alignment:
| Q |
1 |
gttataattatcaaaatttttataagaatcctcggttgatgtgatggttagagtcgatacttgatcattccataacatgcaggcaccgttnnnnnnntca |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23178397 |
gttataattatcaatatttttataagaatccccggttgatgtgatggttagagtcggtacttgatcattccataacatgcaggcaccgtcaaaaaaatca |
23178298 |
T |
 |
| Q |
101 |
taagcataagcaacacaagagcaatcattgaagcaagtataattacactgtgctgcggtatccaccagcctgtgcacacgatgacgtcgaagtgatttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23178297 |
taagcataagcaacacaagagcaatcattgaagcaagtataattacactgtgctccggtatccaccagcctgtgcacacgatgacgtcgaagtgatttca |
23178198 |
T |
 |
| Q |
201 |
ctgacatattaaaggatgagaaatatc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
23178197 |
ctgacatattaaaggatgagaaatatc |
23178171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University