View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10178_low_32 (Length: 218)
Name: NF10178_low_32
Description: NF10178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10178_low_32 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 30520614 - 30520831
Alignment:
| Q |
1 |
attagtggatgaaaatcttccaattgttgttatagctacacgtgatgtttgcttcaggttggttgttttgactgttgagtagctttatgatctgaaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30520614 |
attagtggatgaaaatcttccaattgttgttatagctacacgtgatgtttgcttcaggttggttgttttgactgttgagtagctttatgatctgaaatta |
30520713 |
T |
|
| Q |
101 |
tgagtttcatattgacatcttttacatttggcagcaaacagcagtctgttattcagcaacttcatgctcgcagaggtcgcctgatagttatgtgttcaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30520714 |
tgagtttcatattgacatcttttacatttggcagcaaacagcagtctgttattcagcaacttcatgcccgcagaggtcgcctgatagttatgtgttcaaa |
30520813 |
T |
|
| Q |
201 |
aggtgatgctgcttctgt |
218 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
30520814 |
aggcgatgctgcttctgt |
30520831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University