View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_13 (Length: 326)
Name: NF10179_high_13
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 8 - 326
Target Start/End: Original strand, 26692860 - 26693179
Alignment:
| Q |
8 |
agaagcaaaggtaaaggggtaaagggacaacaaaaatgatcaaccaacagaaaagtgaggacaaaaactgaacgcaaaggtaagaactaagaacatgggg |
107 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26692860 |
agaaacaaaggtaaagggataaagggacaacaaaaatgatcaaccaacagaaaagtgaggacaaaaactgaacgcaaaggtaagaactaagaacatgggg |
26692959 |
T |
 |
| Q |
108 |
taaattaaagttgttgctaacccatggttcttggaaaagagatagcaccaaaacagagatgggcgctctcatggggtaatggtagcttcacgtgcaaagt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26692960 |
taaattaaagttgttgctaacccatggttcttggaaaagagatagcaccaaaacagagatgggcgctctcatggggtaatggtagcttcacgtgcaaagt |
26693059 |
T |
 |
| Q |
208 |
gtaagggacaaagttccggagcaattaagcaagtgattagacagttaattgaag-aaagtaattaaatgccaccaattaattatggacacgaaactgaaa |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26693060 |
gtaagggacaaagttccggagcaattaagcaagtgattagacaattaattgaagaaaagtaattaaatgccaccaattaattatggacacgaaactgaaa |
26693159 |
T |
 |
| Q |
307 |
ttaaagctcaaagttgaagt |
326 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26693160 |
ttaaagctcaaagttgaagt |
26693179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University