View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10179_high_16 (Length: 289)

Name: NF10179_high_16
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10179_high_16
NF10179_high_16
[»] chr2 (1 HSPs)
chr2 (15-274)||(34012197-34012456)


Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 15 - 274
Target Start/End: Original strand, 34012197 - 34012456
Alignment:
15 gatgatgacatcgacgatatcgtcaacaacgaggttgttaacgatagcgacgagtacgaggaggacgagtatcagtatcactacgaagaagattatgaaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
34012197 gatgatgacatcgacgatatcgtcaacaacgaggttgttaacgatagcgacgagtacgaggaggacgagtatcagtatcactacgaagaagatgatgaaa 34012296  T
115 aagaagaaaccaaacagccacaaaaacgttgttcatcttctttttcattgagtaaggtattacttgatccaagaggaaaatgggctgaagaatggaatag 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34012297 aagaagaaaccaaacagccacaaaaacgttgttcatcttctttttcattgagtaaggtattacttgatccaagaggaaaatgggctgaagaatggaatag 34012396  T
215 agtatttcttttggtgtgtgcaatggggttatttgtggacccacttttcttctatgcaat 274  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34012397 agtatttcttttggtgtgtgcaatggggttatttgtggacccacttttcttctatgcaat 34012456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University