View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_17 (Length: 289)
Name: NF10179_high_17
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 20405670 - 20405379
Alignment:
| Q |
1 |
gataagaaattggtttccatgtttcagcattgttgtactcttaagaatcatggcccagttttcctgtgatgtaacataatttgagattatcaacttcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20405670 |
gataagaaattggtttccatgtttcagcgttgttgtattcttaagaatcatggcccagttttcctgtgatgtaacataatttgagattagcaacttcatt |
20405571 |
T |
|
| Q |
101 |
tagtgagattaaatacctcacccaaaacctcttgcagataaaggtttacaacccttatgcaaagctattgtcaccatcttccttt--------------- |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20405570 |
tagtgagattaaatacctcacccaaaacctcttgcagattgagttttacaacccttatgcaaagctattgtcaccatcttccttttttcagggtatccac |
20405471 |
T |
|
| Q |
186 |
-------tttaatccatctttctaaattttacttgaacatgctttggatcaaatgatttcactaactatactctacttgcaatatagagtga |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20405470 |
tctatattttaatccatctttctaaattttacttgaacatgctttggatcaaatgatttcactaactatactctacttgcaatatagagtga |
20405379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University