View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_22 (Length: 278)
Name: NF10179_high_22
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 111 - 259
Target Start/End: Original strand, 38842423 - 38842571
Alignment:
| Q |
111 |
taacagtttttcactttgtcaggatttacaccctcaacctttaacttatttaaaccctcaatcaagtaagttatccatccaagatttattatatattatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842423 |
taacagtttttcactttgtcaggatttacaccctcaacctttaacttatttaaaccctcaatcaagtaagttatccatccaagatttattatatattatt |
38842522 |
T |
 |
| Q |
211 |
ccttaaaagcgatgcttatgtggcagtgatacaaaaaataccactactt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842523 |
ccttaaaagcgatgcttatgtggcagtgatacaaaaaataccactactt |
38842571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 112
Target Start/End: Original strand, 38842126 - 38842163
Alignment:
| Q |
75 |
ctgacaaatattagtaggttaatttaattgttatctta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842126 |
ctgacaaatattagtaggttaatttaattgttatctta |
38842163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University