View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_26 (Length: 261)
Name: NF10179_high_26
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 45382566 - 45382318
Alignment:
| Q |
1 |
ctttcttcactagctacagcaatcttatgaaggtaaaaaggagtaagctcttttctaacttcttcaggtatctttgatagtcttcttgtttctctattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382566 |
ctttcttcactagctacagcaatcttatgaaggtaaaaaggagtaagctcttttctaacttcttcaggtatctttgatagtcttcttgtttctctattca |
45382467 |
T |
|
| Q |
101 |
ttatcacccatgtgctgtatcaaagacaaagtttcctattaacatattatttggtattataaatcataacatattttggatgcataaaaaagtatatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382466 |
ttatcacccatgtgctgtatcaaagacaaagtttcctattaacatattatttggtattataaatcataacatattttggatgcataaaaaagtatatgaa |
45382367 |
T |
|
| Q |
201 |
ataatgcaccttgttgctttagttatgatctctttggtacaacgatctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382366 |
ataatgcaccttgttgctttagttatgatctctttggtacaacgatctc |
45382318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University