View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_35 (Length: 239)
Name: NF10179_high_35
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 21435796 - 21435936
Alignment:
| Q |
1 |
taactggcaatgatattatagacaaagtttgtatagatgacnnnnnnngagatacataaaaaattatctctggtacatggcagaacctgctaattgcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21435796 |
taactggcaatgatattatagacaaagtttgtatagatgacaaaaaaagagatacataaaaaattatctctggtacatgacagaacctgctaattgcatt |
21435895 |
T |
 |
| Q |
101 |
atgcaatctataatttcatttgccaatggtataatctatga |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21435896 |
atgcaatctataatttcatttgccaatggtataatatatga |
21435936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University