View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_38 (Length: 239)
Name: NF10179_high_38
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 5 - 203
Target Start/End: Original strand, 52045776 - 52045974
Alignment:
| Q |
5 |
atgattcatttctaactcatcagcacttagaatagattacacaaatttcttctaacttaatcaagatattgagtttgaatatgagtttagaaatataata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52045776 |
atgattcatttctaactcatcagcacttagaataaattacacaaatttcttctaacttaatcaagatattgagtttgaatatgagtttagaaatatagta |
52045875 |
T |
 |
| Q |
105 |
ctgttaaatttttcagaaagagattgccgtttattgaagtcaatgagactcgagagattaatttctccgtttgtccaccgaagagactcgatttacaac |
203 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52045876 |
gtgttaaattttttagaaagagattgccgtttattgaagtcaatgagactcgagagattaatttctccgtttgtccaccgaagagactcgatttacaac |
52045974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University