View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_45 (Length: 212)
Name: NF10179_high_45
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 41676245 - 41676446
Alignment:
| Q |
1 |
ttgatactcacttctgtactgcatcacnnnnnnnaggtatttgtggatcacccttcattccatagaccagggaatccttatggagacaagcacgggacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41676245 |
ttgatactcacttctgtactgcatcactttttttaggtatttgtggatcacccttcattccatagaccagggaatccttatggagacaagcacgggacgt |
41676344 |
T |
 |
| Q |
101 |
ttaaggataatcaggtataatcttacttctagctttgatggtagattagcattctacttccatcctttatatatgaataataataaattttcttctcctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41676345 |
ttaaggataatcaggtataatcttacttctagctttgatggtagattagcattctacttccatcctttatatatgaataataataaattttcttctcctt |
41676444 |
T |
 |
| Q |
201 |
tg |
202 |
Q |
| |
|
|| |
|
|
| T |
41676445 |
tg |
41676446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University