View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10179_high_8 (Length: 394)
Name: NF10179_high_8
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10179_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 170 - 378
Target Start/End: Complemental strand, 40626975 - 40626767
Alignment:
| Q |
170 |
tttagtttggtagtttacatatttgtatttgggacaaaagttgtctcattgtagcaacaaaaatcttagtttttgtccgatttcttaccctccattatgt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40626975 |
tttagtttggtagtttacatatttgtatttgggacaaaagttgtctcattgtagcaacaaaaatcttagtttttgtccaatttcttaccctccattatgt |
40626876 |
T |
 |
| Q |
270 |
cttgtatcatgaatagttttaaatcaagttgtaccattgaattccatattttctacaaaccaagcgcaccctcgctcacttttgatataacgcttcgtcc |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
40626875 |
cttgtatcatgaatagttttaaatcaagttgtaccattgaattccatattttctacaaatcaagcgcatcctcgctcacttttgatataacgctttgtcc |
40626776 |
T |
 |
| Q |
370 |
accctttca |
378 |
Q |
| |
|
||||||||| |
|
|
| T |
40626775 |
accctttca |
40626767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 40627129 - 40627058
Alignment:
| Q |
16 |
agatcaagagagggagatagacacatattttggaaggagagagtaattggaagtagatgatccattttgaaa |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40627129 |
agatcaagagagggagatagacacatattttggaaggagagagtaattggaagtagatgatccattttgaaa |
40627058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University